T t

Promoter Transcription start ORF —> ORF end

CAP site Translation start Translation stop

Exon One

Intron

Exon Two t polyA site

Transcription via RNA pol II, capping and cleavage/polyadenylation

Pre-mRNA

5' splice site

3' splice site

G(cap) a 150 bases aagaugguc 150 bases aggugagu 300 bases cucaccaggu 450 bases uaa 25 bases aauaaa aaaaaaaaa„3'

Translation start t

Translation stop polyA tail

Splice junction mRNA 5' 7mG(cap) a 150 bases aagaugguc 150 bases ag:gu 450 bases uaa 25 bases aauaaa aaaaaaaaa„ 3'

t Translation start t Translation stop polyA tail

Fig. 13.9 A "high-resolution" example of mRNA processing. The sequence of a hypothetical pre-mRNA transcript is shown. The transcript is capped and polyadenylated, and splicing removes a specific sequence of bases (the intron). This results in the formation of a translational reading frame as shown.

"D

1. Splicing to reveal a cryptic translational reading frame downstream of another. (Common in retrovirus replication)

ORF-1

ORF-2

5' splice

3' splice

Intron with ORF-1 degraded

ORF-2

AAAn

2. Splicing to change a translation terminator and to fuse two translational reading frames. (Common in papovavirus replication)

ORF-1

5' splice 3' splice

AAAn

Intron with C-terminal part of ORF-1 and N-terminal part of ORF-2 degraded

ORF-1/2

3. Removal of a long "leader" sequence to generate "normal"-sized mRNA (seen in the generation of late adenovirus mRNA and Epstein-Barr virus latency mRNAs)

5' splice j

3' splice

Intron with leader degraded

4. Generation of mRNA "families" encoding related proteins by using alternate splice sites (common in adenovirus and papovavirus replication) Note: Only one of the two happens to any given mRNA

ORF-1

ORF-2

ORF-3

AAAn

Introns degraded l j

5' splice

3' splice B

ORF-1

ORF-3

^ Introns degraded AAA

ORF-1

ORF-2

ORF-3

Fig. 13.10 Some splicing patterns seen in the generation of eukaryotic viral mRNAs. (a) Schematic representation of different splice patterns that have been characterized. (b) Molecular characterization of spliced transcripts. The formation of a hybrid between a fragment of DNA encoding a transcript and the final, processed mRNA will result in any introns present in the DNA looping out of the hybrid. These can be visualized by electron microscopy, by differential nuclease digestion and gel electrophoresis, or by sequence analysis of the cDNA generated from the transcript and comparison with the DNA sequence of the gene encoding it, as shown in simplified form in Fig. 13.6. (c) Schematic representation of an electron micrograph of ssDNA introns (arrows) formed by hybridization of adenovirus DNA and late mRNA that has a complexly spliced leader (see Chapter 17). (Based on data in Berget SM, Moore C, Sharp PA. Spliced segments at the 5'-terminus of adenovirus 2 late mRNA. Proceedings of the National Academy of Sciences of the United States of America 1977;74:3171-3175.) (d) Generation of a polymerase chain reaction (PCR) product from HSV latency-associated RNA (LAT) by using primers annealing to regions 5' and 3' of an intron. The gene encoding the HSV latency-associated transcript is about 9 kbp long, and there is a 2-kb intron that is located about 600 base pairs 3' of the transcription start site (see Chapter 17 and Fig. 17.2, Part IV). PCR amplification of HSV DNA using the first primer set [P1 : P(— 1)] shown produces a product about 150 nucleotides (nt) long. Amplification using the second primer pair [P2 and P(—2)] will produce a fragment longer than 2000 nucleotides and cannot be seen. Next, LAT RNA from latently infected cells is used as a template for the synthesis of cDNA complementary to it (see Chapter 19). When the first primer pair is used for PCR amplification of LAT cDNA, a product the same size as that formed using genomic DNA as a template is formed. By contrast, however, when primer set 2 is used, the product of the cDNA is only about 160 base pairs long since the 2000-base intron has been spliced out. If the product of PCR primer set 2 were subjected to sequence analysis and compared to the sequence of viral DNA, a discontinuity at the splice sites would be revealed.

(b) RNA Double-stranded DNA

restriction endonuclease fragment

Annealing in 80% formamide, u 0.4 M NaCl, 60-63" C

Fig. 13.10 Continued conditions where the RNA will displace its cognate DNA strand and anneal to its complementary strand. The displaced DNA will form a loop around the hybrid. Shadowing of the hybrid molecule will form heavy shadows where the nucleic acid is double-stranded, and finer shadows where it is single stranded. When such a structure is spread and shadowed for visualization in the electron microscope, the RNA—DNA hybrid can be seen as a region of heavy shadowing connecting a loop of lightly shadowed ssDNA.

For visualization and mapping of splices, ssDNA is hybridized with RNA, and the DNA-RNA duplexes will form heavy shadowed images. Any unhybridized DNA in the interior of a gene will form a single-stranded loop that will shadow lightly, as is shown in Fig. 13.10(c). Knowledge of the size of the DNA and the RNA being hybridized allows calculation of where the transcript starts and ends on the DNA strand used for hybridization, and the dimensions of the looped regions provide a measure of the introns' size.

A second method involves the hybridization of radiolabeled DNA with the transcript under study. After the hybrids are formed, the material is divided into two aliquots. One is digested with the endonuclease S1-nuclease. This enzyme is able to cleave randomly within any ssDNA molecule, and will digest all unhybridized DNA whether it is at the end of the probe or present in an unhybridized intron loop. The second aliquot is digested with an exonuclease, exonuclease VII, which digests ssDNA but can only begin digestion at a free end. Digestion of the hybridized material will result in the ssDNA fragments at the ends of the hybridized duplex being digested, but will leave the intron loops intact. The two samples are then denatured with alkali, which hydrolyzes the RNA, and the alkali-resistant labeled DNA is fractionated on a denaturing

Il I

Origin

Tscp-Y

1 II

Stable intron

a4 a22

Ori(s) Trscp

Primer set 1 Primer set 2

RNA RNA

P1:P(-1) P2:P(-2) spliced LAT transcript >500 nt

Product size

140 nt

Fig. 13.10 Continued electrophoresis gel. The number of products of endonuclease digestion will be one more than the number of introns in the transcript, and the total size of the fragments will be equal to the total amount of the gene expressed as exons. By contrast, only a single fragment will result from exonuclease digestion, and its size will be equal to the sum of the sizes of the exons and introns. A complexly spliced transcript cannot be fully analyzed in a single experiment. However, a series of analyses of the products of Sj-nuclease and exonuclease VII digestion of hybrids formed with different portions of the gene encoding a transcript generated by restriction endonuclease digestion will yield a complete picture.

The third, and most detailed and sensitive approach toward characterizing a spliced transcript and its relationship to the DNA encoding it is to carry out comparative sequence analysis of the gene and the cDNA generated from the transcript. This cDNA can be detected by PCR amplification of even extremely rare transcripts; therefore, a detailed picture of the splicing patterns of very-low-abundance mRNAs is technically quite feasible. An example of the generation of a PCR-amplified cDNA from a low-abundance latency-associated transcript of HSV is shown in Fig. 13.10(d). Latent-phase transcription by herpesviruses is discussed in more detail in Chapter 17, Part IV.

Posttranscriptional regulation of eukaryotic mRNA function

The many steps in the biogenesis of eukaryotic mRNA are outlined in Fig. 13.11; each is subject to control. Thus, chromatin structure controls the availability of the transcription template, while the interaction between regulatory sequences within the overall transcription unit and regulatory proteins activates transcription. The processing and transport of mRNA in the nucleus is also subject to control, as is the ability of mRNA to associate with ribosomes in the cytoplasm. Finally, as noted briefly in Chapter 8, Part II small cellular RNAs (microRNAs) with double-stranded regions and double-stranded RNA expressed by aberrant transcription from exogenous sources such as viruses are cleaved by a cellular enzyme complex termed dicer into short 20—30 base sequences, which can interact with complementary sequences of mRNA leading to blockage of protein synthesis and mRNA degradation.

Alternate splicing

Alternate splicing

► MicroRNAs mRNA transport

Cytoplasm

Nucleus mRNA transport

Cytoplasm

Fig. 13.11 Posttranscriptional regulation of eukaryotic mRNA. Once transcribed, eukaryotic mRNA must be processed by splicing, and transported to the nucleus. Both of these processes can be regulated. In addition to modulation of the precise nature of mRNA sequence being expressed from a transcription unit, and the rate at which it is released to the nucleus, the small double-stranded RNAs either expressed in the cell or via introduction by another process such as viral replication can be processed into very small RNA sequences that bind to complementary mRNA sequences leading to inhibition of protein synthesis and degradation of the mRNA. Transcribed mRNA can also be edited in the cytoplasm leading to alterations in sequence.

Nucleus small RNA

Dicer

5' 7-mG Cap mRNA editing

AAAAAAA

Nascent proteins mRNA editing

AAAAAAA

Nascent proteins

Virus-induced changes in transcription and posttranscriptional processing

Many RNA-containing viruses completely shut down host transcription. Specific details are described in Chapters 14 and 15. The ability of DNA viruses to transcribe predominantly viral transcripts is usually a multistep process with the earliest transcripts encoding genes that serve regulatory functions, causing expression of viral genes to be favored. The mechanism of transcriptional shutoff varies with different viruses. With nuclear-replicating DNA viruses, the process often involves these earliest transcripts being expressed from a viral promoter that has a powerful enhancer, allowing active transcription without extensive modification of the cell. This is followed by changes in the structure of cellular chromatin and increases in viral genomes so that viral transcription templates begin to predominate relatively rapidly.

A major factor in usurpation of the cell's transcriptional capacity by these viruses is the fact that, in general, the uninfected cell has much more transcriptional capacity than it is using at the time of infection. Consequently, increases in the availability of viral templates, along with alterations of the host chromatin structure, result in virus-specific transcription predominating.

Some nuclear-replicating viruses also encode regulatory proteins that affect posttranscrip-tional splicing and transport of transcripts from the nucleus to the cytoplasm. Such alterations in splicing do not affect the basic mechanism of splicing, but can specifically inhibit the generation and transport of spliced mRNA at specific times following infection. This inhibition involves the ability of viral proteins to recognize and modify the activity of spliceosomes. The alteration of splicing and transport of mRNA has especially important roles in aspects of the control of herpesvirus gene expression and in the regulation of viral genome production in lentivirus (retrovirus) infections. Specifics are described in Chapters 17 and 20.

While no nuclear-replicating DNA viruses of vertebrates yet characterized encode virus-specific RNA polymerase, at least one, baculovirus, which replicates in insects, does. Further, this is a very common feature in DNA-containing bacteriophages. Indeed, as outlined in Chapter 18, changes in the infected bacteria's polymerase population is the major mechanism for ensuring virus-specific RNA synthesis and the change in types of viral mRNA expressed at different times after infection. This is also seen in the replication of the eukaryotic poxviruses, which replicate in the cytoplasm of the infected host cell, and thus do not have access to cellular transcription machinery (see Chapter 18, Part IV).

One other posttranscriptional modification, RNA editing, has been observed in the replication of some viruses. RNA editing is an enzymatic process that is commonly seen in the biogenesis of mitochondrial mRNAs. One form of editing is found in the replication of hepatitis delta virus (see Chapter 15, Part IV). This editing reaction results in the deamination of an adenosine base in the viral mRNA and its conversion to a guanosine, which leads to alteration of a translation signal and expression of a larger protein than is expressed from the unmodified transcript. A second form of RNA editing that occurs as the RNA is expressed is the addition of extra bases to regions of the RNA. This is seen in the replication of some paramyxoviruses viruses and in Ebola virus.

The mechanism of protein synthesis

Like transcription, the process of protein synthesis is similar in broad outline in prokaryotes and eukaryotes; however, there are significant differences in detail. Some of these differences have important implications in the strategies that viruses must use to regulate gene expression. Viruses use the machinery of the cell for the translation of proteins, and to date, no virus has been characterized that encodes ribosomal proteins or rRNA. However, some viruses do modify ribosome-associated translation factors to ensure expression of their own proteins. A notable example of such a modification is found in the replication cycle of poliovirus described in Chapter 14.

Eukaryotic translation

In a nucleated cell, processed mRNA must be transported from the nucleus. The mRNA does not exist as a free RNA molecule, but is loosely or closely associated with one or a number of RNA-binding proteins that carry out the transport process and may facilitate initial association with the eukaryotic ribosome. This provides yet another point in the flow of information from gene to protein that is subject to modulation or control, and thus is potentially available for viral-encoded mediation.

The features of translational initiation in eukaryotic cells reflect the nature of eukaryotic mRNAs, namely, that they have 5'-methylated caps, that they are translated as monocistronic species, and that ribosomes usually do not bind to the messages at internal sites. Initiation involves assembly of the large (60s) and small (40s) subunits of the ribosome along with the initiator tRNA (met-tRNA in most cases) at the correct AUG codon. These steps require the action of several protein factors along with energy provided by ATP and GTP hydrolysis. The process is shown in Fig. 13.12.

The first phase of this process involves association of the 40s subunit with met-tRNAmet and is carried out by three eukaryotic translation initiation factors (eIF-2, eIF-3, and eIF-4C) along with GTP. This complex then binds to the 5'-methylated cap of the mRNA through the action of eIF-4A, eIF-4B, eIF-4F, and CBP1 (cap-binding protein) requiring the energy ofATP hydrolysis.

The 40s-tRNA complex then moves in the 5' to 3' direction along the mRNA, scanning the sequence for the appropriate AUG that is found within a certain sequence context (the Kozak sequence). Movement of the complex requires energy in the form of ATP. Finally, the 60s subunit joins the assembly through the activity of eIF-5 and eIF-6, GTP is hydrolyzed, all of the initiation factors are released, and the ribosome-mRNA complex (now called the 80s initiation complex) is ready for elongation.

The new peptide "grows" from N-terminal to C-terminal and reads the mRNA 5' to 3'. Translation proceeds to the C-terminal amino acid of the nascent peptide chain, the codon of which is followed by a translation termination codon (UAA, UGA, or UAG). The sequence of bases, starting with the initiation codon, containing all the amino acid codons, and finishing with the three-base termination codon, defines an open translational reading frame (ORF). In mature mRNA, any ORF will have a number of bases evenly divisible by three, but an ORF may be interrupted by introns in the gene encoding the mRNA.

Several ORPs can occur or overlap in the same region of mRNA, especially in viral genomes. Overlapping ORFs can be generated by splicing or by AUG initiation codons being separated by a number of bases not divisible by three. An example might be as follows (where lowercase bases represent those not forming codons):

5'- . . . AUGAAAUGGCCAUUUUAACGA . . . -3' Translated in "frame 1," the sequence would be read: AUG AAA UGG CCA UUU UAA

but in "frame 3," it would be read: augaa AUG GCC AUU UUA A

In such an mRNA, ribosomes might start at one or the other translational reading frame, but a given ribosome can only initiate translation at a single ORF. Thus, if the ribosome initiates translation of, say, the second ORF, this is because it has missed the start of the first one, and if it has started at the first one, it cannot read any others on the mRNA. In other words, when a eukaryotic ribosome initiates translation at an ORF, it continues until a termination signal is encountered. Translation termination results in the ribosome falling off the mRNA strand, and any other potential translational reading frames downstream of the one terminated are essentially unreadable by the ribosome.

This simply means that a eukaryotic mRNA molecule containing multiple translational reading frames in sequence will not be able to express any beyond the first one translated (or,

Igf1 Signaling
80S initiation complex

Fig. 13.12 Initiation of eukaryotic translation. Note the initiation complex contains the 40s ribosomal subunit and must interact with the 5' end of the mRNA molecule via the cap structure or an equivalent. The 60s subunit only becomes associated with the complex at the Kozak (or equivalent) sequence. The ribosome dissociates back into the two subunits at the termination of translation. This means that internal initiation, especially if an upstream open reading frame has been translated, is impossible or at least extremely rare. Pi = inorganic phosphate; Ppi = pyrophosphate.

possibly two, if the ribosome has a "choice") from the 5' end of the transcript. Any ORFs downstream of these are considered hidden or cryptic ORFs. This property of eukaryotic translation has important implications both in the effect of splicing on revealing "cryptic" or hidden translational reading frames, and in the generation of some eukaryotic viral mRNAs.

Prokaryotic translation

Prokaryotic messages have three structural features that differ from eukaryotic versions. First, mRNA is not capped and methylated at the 5' end. Second, mRNA may be translated into more than one protein from different coding sequences and is, thus, polycistronic mRNA. Finally, ribosome attachment to mRNA in prokaryotes occurs at internal sites rather than at the 5' end. In addition, prokaryotic mRNAs are transcribed and translated at the same time and in the same place in the cell (coupled transcription/translation).

Features of prokaryotic translation reflect these structural and functional differences. Initiation, shown in Fig. 13.13, begins with the association of initiator tRNA (A-formyl-methionine-tRNA, or F-met-tRNA) with the small (30s) ribosomal subunit, together with mRNA through the action of three factors (IF-1, IF-2, and IF-3), along with GTP. The complex that forms involves direct binding of the 30s subunit with its F-met-tRNA to the AUG that initiates translation of the ORF.

This AUG is defined by the presence of a series of bases (called the Shine—Dalgarno sequence) in the mRNA upstream from the start codon that is complementary to the 3' end of the 16s rRNA in the 30s ribosomal subunit. The large (50s) ribosomal subunit now binds, accompanied by GTP hydrolysis and release of factors, to form the 70s initiation complex.

Fig. 13.13 Initiation of translation of a prokaryotic mRNA. This can occur anywhere there is a Shine—Dalgarno sequence in the mRNA since the 30s ribosome associates with the mRNA at that site by virtue of the presence of a complementary sequence in the 3' end of the ribosomal RNA. fMet=formylmethionine.

Fig. 13.13 Initiation of translation of a prokaryotic mRNA. This can occur anywhere there is a Shine—Dalgarno sequence in the mRNA since the 30s ribosome associates with the mRNA at that site by virtue of the presence of a complementary sequence in the 3' end of the ribosomal RNA. fMet=formylmethionine.

Querschnitt Linoleum
50S large ribosomal subunit

16S rRNA

16S RNA in 30S ribosomal subunit associates with mRNA through the Shine-Delgarno sequence

5' ppp 70S initiation complex

From this point, elongation and termination occur in much the same manner as seen in eukary-otic cells.

Virus-induced changes in translation

Many viruses specifically alter or inhibit host cell protein synthesis. The ways they accomplish this vary greatly, and are described in Part IV where the replication cycle of specific viruses is covered in detail. Some viruses, notably retroviruses and some RNA viruses, can also suppress the termination of translation at a specific stop codon. The mechanism for such suppression may involve the ribosome actually skipping or jumping a base at the termination signal. When this happens, the translational reading frame being translated is shifted by a base or two. Other modes of suppression are not so well characterized, but all involve the mRNA at the site of suppression having a unique structure that facilitates it. This suppression is not absolute, but occurs with either high or low frequency resulting in a single mRNA translational reading frame being able to encode multiple, related proteins.

QUESTIONS FOR CHAPTER 13

1 A given mRNA molecule has the following structure. What is the maximum number of amino acids that the final protein product could contain?

Cap-300 bases-AUG-2097 bases-UAA-20 bases-AAAA

2 Assume the following sequence of bases occurs in an open reading frame (ORF) whose reading frame is indicated by grouping the capitalized bases three at a time:

. . . AUG . . . (300 bases) . . . CGC AAU ACA UGC CCU ACC AUG AAU AAU ACC UAA gguaaaug...

What effect might deletion of the fourth A in the above strand of mRNA have on the size of a protein encoded by this ORF?

3 Both prokaryotic and eukaryotic cells transcribe mRNA from DNA and translate these mRNAs into proteins. However, there are differences between the two kinds of cells in the manner in which mRNAs are produced and utilized to program translation. In the table below, indicate which of the features applies to which kind of mRNA. Write "Yes" if the feature is true for that kind of mRNA or "No" if it is not true.

Feature

Eukaryotic mRNA

Prokaryotic mRNA

The small ribosomal subunit is correctly oriented to begin translation by association with the Shine-Dalgarno sequence

Open reading frames generally begin with an AUG codon

The 5' end of the mRNA has a methylated cap structure covalently attached after transcription

During protein synthesis, an open reading frame can be translated by more than one ribosome, forming a polyribosome

Termination of transcription may occur at a site characterized by the formation of a GC-rich stem loop structure just upstream from a U-rich sequence

4 Which of the following statements is/are true

(c) Polyadenylated 3' tail.

regarding the primer for most DNA replication?

(d) Nuclear splicing of most mRNAs.

(a) It is degraded by an exonuclease.

(e) The use of AUGs instead of ATGs.

(b) It is made up of ribonucleic acid.

(c) It is synthesized by a primase.

6 In what cellular location would one find viral

glycoproteins being translated?

5 All of the following are characteristics of eukaryotic

mRNA, except:

7 What is the minimum size of a viral mRNA encoding a

(a) A 5'-methylated guanine cap.

structural protein of 1100 amino acids?

(b) Polycistronic translation.

Was this article helpful?

0 0
How To Bolster Your Immune System

How To Bolster Your Immune System

All Natural Immune Boosters Proven To Fight Infection, Disease And More. Discover A Natural, Safe Effective Way To Boost Your Immune System Using Ingredients From Your Kitchen Cupboard. The only common sense, no holds barred guide to hit the market today no gimmicks, no pills, just old fashioned common sense remedies to cure colds, influenza, viral infections and more.

Get My Free Audio Book


Post a comment