Polymerase Chain Reaction

Polymerase chain reaction (PCR) enables one to determine if a specific needle is present in a haystack, and it can be used as a step toward the characterization of the needle. It is a quick, powerful, inexpensive DNA amplification technique that has become a fundamental tool in molecular pathology.

Theory

The PCR is one of the most significant technical innovations in molecular biology.1 The PCR was devised by Kary Mullis and colleagues2,3 at Cetus Corporation in California and was first described in a 1985 paper demonstrating its application in the prenatal diagnosis of sickle cell anemia2 and then further described in an ensuing paper.3 These works detailed how a DNA sequence could be enzymatically amplified in vitro using specific oligonucleotide primers and bacterial (Klenow) DNA polymerase. With refinement of PCR over the next 3 years, it was found that a robust PCR using a thermostable polymerase could amplify a DNA sequence by a factor of more than 107, even when the target DNA made up only 1 of 100,000 DNA strands in a reaction.4 Since then, additional improvements and variations to the original reaction have been made, affording even more efficiency, sensitivity, and utility to this tool. Its application specifically to diseases of the lungs has ranged from detection of infectious diseases5-7 to study of inflammatory mechanisms,8 ,9 to use in mutation analysis,10-12 to detection of tumors and metastases.13-15

Principles

The principle of PCR is illustrated in Fig. 9.1. The target DNA to be amplified in vitro can be human genomic, bacterial, viral, plasmid, or previously PCR-amplified DNA and is represented in the figure by the target's nucleotide base letters A, C, G, and T and the sugar phosphate backbone. Other components of PCR include a thermostable DNA polymerase such as Taq polymerase, two oligonucleotide primers, four deoxynucleotide triphosphates, magnesium, buffer, and a thermocycler. PCR achieves amplification of the DNA by repeating a three-step cycle over and over. These three steps are denaturation, annealing, and extension.

In the denaturation step, target double-stranded DNA (dsDNA) is heated to a high temperature (94-95°C) to break the hydrogen bonds between nucleotide bases on opposing strands. The dsDNA denatures, splitting into two intact single strands (ssDNA) that are complementary to each other. In the second (annealing) step, the reaction mix is cooled, typically to 50-65°C, allowing ssDNA oligonucleotide primers to bind (anneal) to the portion of the target ssDNA to which they have specifically been designed. The investigator must know the sequence of the target DNA (at least in the region of the primers) to design the primers. Two primers are required: one that is complementary to the 3'—> 5'-oriented target strand in Fig. 9.1 (the forward primer), and one primer that is complementary to the 5' ^ 3' target strand in the figure (the reverse primer). Because these primers are in overwhelming abundance compared with the target DNA, they will anneal to the target DNA much more frequently than the full-length target DNA will anneal to its full-length complementary strand as the reaction is cooled. In the third (extension) step, as the temperature is raised to its working optimum (72°C), Taq polymerase recognizes these partially double-stranded DNAs and uses the forward and reverse primers as initiation points to begin extending the primers via polymerization in a 5'--> 3'-direction along the two new (nascent) strands. DNA polymerase does this by selecting high-energy deoxynucleotide triphosphates (dNTPs) from solution and placing them in the nascent strands directly across from their complementary base in the template (target) strand. During the first round (cycle) of PCR, the DNA polymerases extend the nascent strands for a relatively long distance before falling off. At the end of the first cycle, two double-stranded copies of a portion of the target DNA have been generated from one copy.

Polymerase Chain Reaction
  1. 9.1. Polymerase chain reaction steps. A single double-stranded original. Taq polymerase extends primers by selecting deoxyribo-DNA fragment is denatured and cycled through three steps - dena- nucleotide triphosphates from the reaction solution based on the turation, annealing, and extension - to create an exact copy of the nucleotide sequence of the target DNA.
  2. 9.1. Polymerase chain reaction steps. A single double-stranded original. Taq polymerase extends primers by selecting deoxyribo-DNA fragment is denatured and cycled through three steps - dena- nucleotide triphosphates from the reaction solution based on the turation, annealing, and extension - to create an exact copy of the nucleotide sequence of the target DNA.
Polymerase Chain Reaction Steps Nature

Fig. 9.2. Thirty-five cycles of polymerase chain reaction (PCR). DNA strands are abbreviated as lines . In the first cycle, two long PCR products of variable length (red or green lines) are polymerized, but with ensuing cycles the overwhelming PCR

product is short, as defined by the positions of the forward (red) and reverse (green) primers. In a perfect PCR, several million amplicons are present after 35 cycles and ready for post-PCR analysis .

Fig. 9.2. Thirty-five cycles of polymerase chain reaction (PCR). DNA strands are abbreviated as lines . In the first cycle, two long PCR products of variable length (red or green lines) are polymerized, but with ensuing cycles the overwhelming PCR

product is short, as defined by the positions of the forward (red) and reverse (green) primers. In a perfect PCR, several million amplicons are present after 35 cycles and ready for post-PCR analysis .

During the second cycle (Fig. 9.2, where DNA strands are symbolized by lines) the same process happens, but now the polymerase can only proceed as far down the DNA as the point where the opposite primer started. At the end of the second cycle the PCR products (amplicons) include two relatively short fragments of ssDNA whose two ends now correspond exactly to the locations of the forward and reverse primers. Both the genomic DNA and new amplicons can serve as templates in successive PCR cycles.16 With subsequent cycles, the longer dsDNA PCR products are diluted out by the more numerous shorter dsDNA PCR products.17,18 In a perfect PCR the amount of dsDNA doubles with each cycle so that after 30 cycles there are more than 1 billion copies of the original dsDNA (230 = 1.1 billion) and more than 1 trillion copies after 40 cycles (240 = 1.1 trillion). Because the primers recognize only the target DNA they are designed for, only a specific segment of DNA is amplified, even if it makes up only a fraction of all the different DNA sequences in a reaction.4 This preferential amplification greatly facilitates post-PCR analysis of the target sequence.

PCR cycling is done in a thermocycler, a small automated tabletop instrument programmed by the investigator. A typical program (Table 9.1) starts with a 5-10-min denaturation at 94-95°C to ensure that the majority of the DNA (especially large chromosomal strands) is denatured. This step is followed by 30-50 cycles of brief denaturation/annealing/ extension. The PCR concludes with a 5-10-min final polymerization step at 72°C to ensure nearly all amplicons are extended to their full length.

Table 9.1 Typical polymerase chain reaction (PCR) thermocycler program.

Temperature (C)

Time

Initial denaturation

95

10 min

Forty cycles of

Denaturation step

95

30 s

Annealing step

57

30 s

Extension step

72

45 s

Final polymerization

72

10 min

Post-PCR hold

4

Indefinite

Practical Polymerase Chain Reaction

Thermocyclers must be properly programmed to create an efficient PCR. Most programs are roughly similar (see Table 9.1), except for the annealing temperature and time intervals of each step. The annealing temperature is dependent on the melting temperature of the primers, and the time spent at the different steps is dictated by the size of the target DNA. The denatur-ation temperature is generally the same in all PCRs (94-95°C), just as the extension temperature is usually 72°C, because most polymerases used in PCR work best at this temperature (but see later discussion of polymerases and real-time PCR).

Denaturation Step Programming

The initial denaturation, which occurs before any cycling, is typically 94-95°C for 5-10 min; this gives human chromosomal DNA time to unravel and split into single strands. Smaller (e.g., viral) DNA targets may require only 3-5 min. Because ssDNA tends to reanneal while cooling, the dsDNA must be redenatured at 94°C for 10-60 s at the beginning of each cycle. GC-rich targets may require hotter/longer dena-turations, while formamide or dimethylsulfoxide (DMSO) can be added to promote denaturation.19 Temperatures above 95°C or excessive cycles should be avoided because Taq stability decreases under these conditions.20

Annealing Step Programming and Primer Design

The annealing temperature varies with every PCR and is a critical factor in the PCR program, as it helps dictate lower limit of detection, sensitivity, and specificity of the PCR. It must be calculated for each unique PCR and is dependent on the melting temperature of the two oligonucleotide primers. The melting temperature (Tm) of a DNA fragment is the temperature at which half of it has denatured into the single-stranded form (e.g., the primer is not annealed to its complementary target) and half is still double-stranded (primer is annealed to its target), assuming the number of copies of the two complementary strands is equal. Melting temperature calculation of an oligonucleotide can be very complex, with formulas that employ thermodynamics and depend on nearest neighbor nucleotides21,22 and the salt concentrations in the reaction. Numerous websites, including those of companies that manufacture custom oligonucleotides, have free Tm calculators; after a primer sequence is typed in, the Tm is instantly calculated. Software is also available that will generate a list of potential primer pairs, with their Tms, once the entire target sequence is entered.

Manual calculation of the approximate Tms of short oligo-nucleotides can also be done using the abbreviated Wallace rule:23

Here Tm is in degrees centigrade, and A, T, C, and G stand for the number of each of these bases in the single-

stranded oligonucleotide sequence. Thus, the approximate Tm of a 22-base pair (bp) (22-mer) poly (A) oligonucle-otide would be only 44°C, whereas the 21-mer CGGCTG CACGCTGCGCCGTCC would have an approximate Tm of 76°C. Because Cs and Gs base pair with three hydrogen bonds, more heat is required to melt them apart in a dsDNA ^ ssDNA conversion compared with As and Ts, which base pair by sharing only two hydrogen bonds.

To design primers, one must first isolate the region of the gene of interest that will be amplified. The human genome and the genomes of many viruses and bacteria are available on the National Center of Biotechnology Information (NCBI) web site ( www.ncbi.nlm.nih.gov/ ). Avoid placing primers in regions with known polymorphisms or splice variants or, in the case of viruses and bacteria, where any subtype/strain variations have been reported in the region of the proposed primers.

To ensure genomic DNA (and not reverse-transcribed mRNA) is being amplified, primers should be located at exon-intron junctions or within introns. To ensure reverse-transcribed RNA is being amplified (from the cDNA; see later), primers should span introns and be within exons. To create a robust PCR, the size of the DNA region amplified (distance of the two primers from each other) should be less than 500 bp and preferably around 200-300 bp. Amplicons larger than 1 kb (kilobase, or 1,000 bp) often require special polymerases (see later) with enhanced processivity. These forward and reverse primers should be only 18-25 bp long, have a 40-60% G + C content, and have T s in the 55-65°C range. Melting temperatures outside this range may work, and in fact are sometimes necessary, but they have a greater likelihood of resulting in a less efficient or more nonspecific PCR. In addition, the primers should have Tms that are within 2°C of each other: add or remove bases to meet this goal. Ideally, the last five bases in the primer should include three Cs or Gs, and the 3'-end of the primers should be a C or G to promote tight base pairing at the point of Taq recognition and initiation of polymerization.

Just as a primer will anneal to its complementary region in the target DNA, so a pair of primers might anneal to complementary regions within themselves or within each other. Thus, TGGCCCATTACACTTGGCCATTT is a poor primer choice because there will be some tendency for the boldface sequences to anneal to each other, forming a hairpin stem-loop structure within itself or to form primer dim-ers between two similar primers. Likewise, a 5'-TAGG-3/ sequence in the reverse primer could transiently anneal to a 5'-CCTA-3' sequence in the forward primer. Many of the web sites that calculate T s also have a tool to check for these m types of structures, as these aberrant forms can significantly reduce the yield of PCR product due to effective reduction of the available primer supply. Finally, avoid repetitive bases at the 3'-end of a primer, as this promotes slippage ("out of register") errors by Taq polymerase. Once all (or as many as feasible) of the foregoing rules are met and two primer sequences have been found, the primers should be checked to be certain they are not complementary to DNA sequences unrelated to the target sequence by using the NCBI BLAST (basic local alignment search tool) database at www.ncbi. nlm.nih.gov/BLAST/. This website will list all published DNA sequences that exactly or closely match the oligo-nucleotide sequences submitted. If one or both primers are close matches to nontarget DNA that may be present in the samples tested, new primer(s) may have to be designed.

The rules are empirical and do not guarantee a large PCR yield for reasons that are not always obvious or easily tested. It is often more expeditious to simply design more than one set of primers using the above rules and test all on a specimen to determine which pair gives the most robust PCR.

What annealing temperature should now be used in the PCR? This choice also requires trial and error. Initially the annealing temperature programmed into the thermocycler should be 5-10°C below the lowest T of the forward and m reverse primers. At such a low temperature there will be mis-priming onto nontarget sequences, resulting in amplification of nonspecific products. To enhance the specificity and perhaps even the sensitivity of the PCR, the temperature should then be systematically raised until amplicon yield drops and, hopefully, nonspecific amplicons disappear. Alternatively, the annealing temperature can be lowered, potentially increasing sensitivity, at the risk of generating nonspecific amplicons in addition to the desired PCR product.

Polymerase Chain Reaction Components

Thermostable Polymerase

The first PCRs used an Escherichia coli DNA polymerase2 that was thermolabile and had to be replaced at each cycle; extension at 37°C would allow the nonspecific priming of numerous genomic sites and thus formation of nonspecific amplicons. Because the cycling of PCR repeatedly raises the reaction to 95°C, a thermostable polymerase is required. Taq polymerase, the most frequently used, was first purified from the bacterium Thermus aquaticus in 1976,24 years before PCR. The enzyme has optimal 5 ' ^ 3' polymerase activity at 80°C (but will inefficiently extend primers at much lower temperatures), requires a divalent cation (Mg2+), extends at a rate of 60 nucleotides/s,2 5 and has a polymerization per binding event (processivity) of 50-80 bases.26Taq has double-strand-specific 5' ^ 3' exonuclease activity (see later discussion of real-time PCR) but does not have 3' ^ 5' exonuclease (proofreading) ability; its estimated error rate is 2.1 x 10-4 errors per base per duplication.27Taq is inhibited in samples containing heparin, hemoglobin, phenol,28 urine, urea,29 ethanol and high formamide, DMSO, or ethylenedi-aminetetraacetic acid (EDTA) levels.

Polymerases with fidelity superior to Taq include Pfu, Pwo, Tgo (from Pyrococcus furiosus, Pyrococcus woesei, and Ther-mococcus gorgonarius, respectively), and Tli (from Ther-mococcus litoralis) has superior thermostability.30Thermus thermophilus polymerase (Tth), unlike Taq, has reverse transcriptase activity (see later) as well as DNA polymerase activity. All these polymerases are readily available from different distributors.

Deoxynucleotides

The four dNTPs needed to replicate DNA are deoxyadenos-ine triphosphate, deoxyguanosine triphosphate, deoxycyto-sine triphosphate, and deoxythymidine triphosphate (dATP, dGTP, dCTP, and dTTP). They are added in equal concentration to the PCR mix, typically with a final concentration of 50-250 mM each in the reaction (200-1,000 mM total for all four dNTPs).

To prevent contamination of a new PCR by previously amplified DNA, deoxyuridine triphosphate (dUTP), instead of dTTP, is added to reactions and incorporated into the amplicons. When the bacterial enzyme uracil-N-glycosy-lase31 is added and activated at the start of subsequent PCRs, it destroys any previously amplified PCR products that contain uracil, but it does not harm the natural TTP-containing DNA of the new sample. Uracil-N-glycosylase is deactivated at temperatures above 50°C and therefore does not destroy the newly polymerized DNA strands made during PCR.

Polymerase Chain Reaction Buffer

Taq requires the correct pH to function throughout the range of temperatures in PCR. The buffer Tris-HCl (10 mM) provides a pH of 8.3 at 25°C but pH 7.2 at 72°C; Taq has improved fidelity at this pH or lower.'2 Potassium chloride (50 mM) stabilizes the DNA and promotes primer annealing to its target. Nonionic detergents such as 0.01% Tween-20 or 0.1% Triton X-100 are often used, as well as gelatin. Fortunately, the above components (depending on manufacturer) are included in optimized 10x PCR buffer solutions provided by most Taq polymerase suppliers and do not have to be added individually to the reaction.

Magnesium

The magnesium concentration is important because it affects PCR specificity and efficiency through its interaction with Taq, whose function is dependent on the divalent cation.33 A free [Mg'+] of 1.2-1.3 mM is optimal for Taq, whereas much higher Mg2+ levels result in increased error rates caused by base substitutions and frameshift errors.32 Magnesium is often included in 10x PCR buffer solutions at a [Mg2+] of 1.5 mM, which decreases to 1.3 mM in the presence of 0.2 mM dNTPs because of equimolar binding of dNTPs and Mg2+ by Taq polymerase.33

Polymerase Chain Reaction Setup

Before starting experiments using PCR, accommodations must be made in the laboratory. Because of the amplification power of PCR, contamination of even minute amounts of DNA from one sample to the next must be avoided. Master mixes, containing all components of the PCR except the DNA, should be set up in a separate, dedicated room or area (hood) away from specimens or post-PCR solutions. DNA or RNA should be isolated from samples in a second room or area. DNA of the samples can then be added to the master mix in a third area, ideally. The thermocycler should also be in a separate room or area of the lab. Keep a unidirectional flow of material from pre-PCR to post-PCR: do not allow PCR-amplified material into the master mix preparation or DNA isolation areas. Label dedicated pipettors and use only aerosol-resistant tips to prevent contamination of pipettor barrels. Wear protective disposable gloves at all times, and change them and laboratory coats when going from one room or area to the next. Use ultraviolet irradiation inside hoods or on benchtops to destroy possible contaminating DNA. Use only autoclaved molecular biology-grade water in master mixes. Make certain that all plastic tubes and tips are DNAse- and RNAse free, as these enzymes will digest the target nucleic acids in specimens.

There is no universal recipe for the PCR mix, but a typical mix, including the DNA, is shown in Table 9.2. However, this is just a start. All PCRs need some adjusting - annealing temperatures, cycle step times, reagents (concentration of each primer, Mg2+ concentration, etc.), primer sequences -to determine the optimal conditions to give the greatest yield, fastest time, or highest specificity.

Postprocedure Analysis

PCR alone does not provide answers to an investigator's questions, but, because of the huge increase in a specific product, it makes the product's analysis much easier. To prove that a target sequence was present in a specimen, amplicons are run out on agarose or polyacrylamide electrophoresis gels to compare their lengths to DNA "ladder" markers; amplicons of the correct size are strong evidence that the target sequence was present. Southern blotting34 with probe hybridization is an alternative. Bacterial restriction endonuclease digestion before electrophoresis or single-stranded conformation polymorphism studies can be done on PCR products to check for mutations.33 DNA sequencing35 of the amplicons or ligation into a plasmid for further analysis are other options, depending on the needs of the researcher.

Table 9.2. Typical polymerase chain reaction (PCR) reagent mix.

H2O (nuclease-free) to final total volume of 25.0 ml dNTPs at 5-10 mM each (20-40 mM total) 0.5 ml

Forward primer at 25 mM 0.3 ml

Reverse primer at 25 mM 0.3 ml

10x PCR buffer with Mg2+ 2.5 ml

Taq polymerase at 1 unit"/ml 1.0 ml

Target DNA 100-500 ng_1.0 ml a One unit of Taq is defined as the amount of enzyme that will incorporate 10 nmole of deoxynucleotide triphosphates into acid-insoluble material in 30 min at 75°C

Variations

Improvements and variations in PCR have been introduced over the past 20 years to meet the needs of researchers and clinical molecular diagnostics labs.

Hot start PCR36 39 is a technique preventing Taq from extending primers until a temperature of 60-80°C is reached, usually done by withholding Taq from the reaction until these temperatures have been reached. This step prevents Taq extension of primer dimers or primers that have annealed to nonspecific regions of the specimen DNA at low temperatures, such as during the preparation of the reagent mix. The result is improved specificity and yield of the PCR and is especially helpful when the target DNA is a small percentage of the total DNA. There are two common hot start methods. The first uses a wax plug to separate key reagents (e.g., dNTPs from Taq) in the PCR tube; the wax melts at a temperature well above the primer Tm and allows mixing of all reagents. The second method uses a modified Taq that is activated only after the initial 95°C 10-min denaturation step.

Nested PCR40,41 uses two pairs of primers to improve amplicon yield and specificity. The first pair ("outer primers") is designed to amplify a larger fragment of the target DNA. These amplicons are then used, usually in a second PCR, as the template DNA for the second set ("inner primers"), which necessarily makes a smaller PCR product. Even if two sequential PCRs are run there may still be four products in the final PCR, the smallest being defined by only the inner primers. If all four primers are added at once and only one PCR is run, the Tm of the inner primers should be lower than that of the outer primers.33

Methylation-specific PCR42-44 is used on genomic DNA to determine if the CpG islands within the promoter of a gene are methylated on the cytosine residue (blocking the gene expression in the cell45) or unmethylated (potentially allowing gene expression). For example, imprinted genes and silenced genes on X chromosomes are methylated,46 as are the promoters of tumor suppressor genes in many cancers.47-49 Methylation-specific PCR is based on the realization that a cytosine converts to a uracil after bisulfite treatment, whereas a methylated cytosine (5-methylcytosine) is refractory and remains as cytosine.50 An unmethylated CpG will be converted to UpG after bisulfite, but a methylated one will remain as CpG. The change in DNA sequence of an unmethylated promoter compared with a methylated promoter after bisulfite treatment allows one to design primers that can discriminate between the two. Whichever of the two primers yields a PCR product indicates the methylation status of the promoter.

Multiplex PCR amplifies multiple different regions of DNA at one time by using multiple primer pairs in one reaction. Several targets can be analyzed in one specimen, including housekeeping genes and variably expressed genes, multiple microorganisms,51 or multiple mutations in a genetic dis-order52 or malignancy.4 3,54 Although ostensibly a 4imesaver, designing primers and optimizing reaction conditions so as to ensure equally robust amplification of all targets in multiplex PCR is a challenge. First, design individual primer pairs (but avoid primer dimers with every other primer), and program the thermocycler to allow optimal amplification of all targets on an individual basis. Then, combine (equimolar) primers and run the same program to see which targets are weakly amplified. Adjust primer concentrations, annealing temperatures, [Mg2+], and so forth to equalize yields of targets. Primer software is also available, but in all cases trial and error are necessary to arrive at the final setup.

Other variations of PCR, each with its unique benefits, include the amplification refractory mutation system,55 allele-specific oligonucleotide probes,56 rapid amplification of cDNA ends,57 and in situ PCR.58 One variant that deserves special attention is real-time PCR.

Real-Time Polymerase Chain Reaction

Real-time PCR59-62 is a recent innovation that has quickly become very popular in molecular biology research and molecular diagnostics. It circumvents the need for time-consuming post-PCR analysis, and it can detect DNA targets, quantify the original (before amplification) copy number of the target DNA present in a specimen, or detect specific mutations. Although very similar to conventional PCR, realtime PCR is based on two additional principles. First, Taq polymerase has a bonus 5' -exonuclease activity on partially double-stranded DNA63; it will digest it to a single-stranded target just before polymerizing it into a double-stranded amplicon. Second, energy can be transferred between fluorescent molecules (fluorophores) attached to oligonucle-otides when these small DNA fragments are used as probes against specific DNA targets. This second principle, first proposed in 1948 by Förster64 and later supported by Stryer and Haugland,55 indicates that electronic excitation energy can be transferred over short distances (£50 Ä) via dipoledipole resonance between an energy donor and acceptor chromophore.66 Transfer efficiency is proportional to the inverse sixth power of the distance separating the donor and acceptor.65

Fluorescence resonance energy transfer (FRET) in realtime PCR is demonstrated in the five frames in Fig. 9.3. A single oligonucleotide (TaqMan® type) probe is designed so that it specifically anneals to its complementary region of a target DNA, somewhere between the forward and reverse primers (top frame of Fig. 9.3). A donor/emitter fluoro-phore covalently attached to one end of this oligonucleotide is stimulated by monochromatic light from a laser, and the energy is transferred to a quencher fluorophore at the other end. In this kind of probe, light is either not reemitted by the quencher or is reemitted at a wavelength different from that of the donor fluorophore. During the primer extension step of PCR (see Fig. 9.3, second frame) the probe remains intact, and the light remains quenched, until degraded into single nucleotides by the 5 ' -exonuclease activity of Taq as it passes through during polymerization of the target DNA (see Fig. 9.3 , third frame). Once cleaved, the emitter nucleotide drifts too far away for its emissions to be quenched, and its fluorescence is recorded in each PCR cycle by a sensitive photodetector and entered into the system's computer. With each PCR cycle, the number of amplicons and the quantity of light double as more probes are cleaved.

Dual-probe real-time PCR (LightCycler® type or hybridization probes', see Fig. 9.3, last two frames) uses donor/ emitter and acceptor probes, designed to anneal side by side on the same target DNA. Fluorescent energy is transferred from the fluorophore of the 5 ,-donor probe (on the left) to the 3 '-acceptor probe (on the right) during the annealing step of PCR. The acceptor immediately reemits at a wavelength unique to its fluorophore, and its signal strength doubles as the number of amplicons doubles with each PCR cycle. The probes separate, and FRET is terminated as the temperature is increased for the denaturation step.

Whether in single- or double-probe real-time PCR, the unique emission spectra of all fluorophores are captured and analyzed throughout each cycle by the real-time instrument software to generate curves such as those in Fig. 9.4. Cycle number is plotted versus fluorescence, and each of the colored curves represents a different specimen. Flat lines indicate no target DNA was in the specimen, and curves that begin rising at a low cycle number represent specimens that had more initial target DNA than those curves that rise later. Note that an exponential increase in fluorescence (and thus amplicon number) occurs only after numerous cycles, when PCR becomes its most efficient. To compare specimen target DNA copy number, a single horizontal threshold line can be drawn through all curves at this exponential phase and then a vertical line dropped from each intersection point to the X (cycle number)-axis. This point on the X-axis is the cycle threshold number of the specimen, and it increases as the original DNA copy number in a specimen decreases. Real-time PCR can be quantitative: a series of controls with a range of known DNA copy numbers are run to generate a standard curve of cycle threshold versus copy number. The cycle threshold values of specimens run simultaneously with the controls can then be converted into original DNA copy number by extrapolating from the standard curve.

Real-time instruments are able to detect fluorescence over a broad range of amplification: dynamic ranges of 7-8 logs can be obtained61 (e.g., specimen DNA copy numbers from 101 to 108 or from 102 to 109 can be detected on the same run). In addition, probes are able to detect even a single base pair change in target DNA, such as in allelic discrimination.67,68

In the design of real-time PCR, the target should be short, preferably less than 150 bp, to maximize amplification efficiency. In some real-time instrument programs the annealing and extension steps are combined into one and run at a temperature of ~60°C. Probes should be designed before the primers and can bind the sense or antisense strand. They

Pcr Slippage Polymerase
  1. 9.3. Real-time polymerase chain reaction (PCR). The top three frames demonstrate single-probe real-time PCR. Quenching ceases once the nucleotide bound to the emitter (yellow) is cleaved by Taq. In the third frame, the forward portion of Taq cleaves the probe (releasing nucleotides), while the back part of Taq extends the forward primer
  2. 9.3. Real-time polymerase chain reaction (PCR). The top three frames demonstrate single-probe real-time PCR. Quenching ceases once the nucleotide bound to the emitter (yellow) is cleaved by Taq. In the third frame, the forward portion of Taq cleaves the probe (releasing nucleotides), while the back part of Taq extends the forward primer

(consuming other nucleotides). The bottom two frames show a dualprobe assay in which probes attach to the target DNA and transfer energy from the yellow to the red fluorophore during the annealing step. They float away during the extension or denaturation step, terminating fluorescence energy transfer, and will not be cleaved by Taq.

0.12 0.11 0.100.090.08 0.07 0.06 0.050.04 0.03 0.02 0.01 0.00 -0.01

0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46

Cycle Number

Fig. 9.4. Amplification curves using a dual-probe real-time polymerase chain reaction (PCR). The PCR cycle number is plotted against fluorescence for seven samples of human genomic DNA being tested for a blood coagulation factor. Note that the specimen represented by the rising curve on the far left contains the most target DNA, as it shows exponential amplification at an earlier cycle. (Courtesy of Mai Le, M, ASCP).

should be <35 bp long, have a GC content of 30-80%, should not have runs of four or more of the same nucleotide, should not partially anneal to each other or to either primer, and should have the 3' -end blocked by phosphorylation to prevent extension by Taq. TaqMan® probes should have a Tm of 68-70°C (about 8-10°C higher than their associated primers, which should have a Tm of 58-60°C), and the 5'-fluorophore should not be bound to a G. LightCycler® probes should optimally be 1-3 bp apart, have a Tm between the extension and annealing step temperatures, and be 5-10°C higher than the primer T ' the T of the two probes should be within 2°C

mm of each other unless mutation detection is desired. Mutation detection is facilitated by looking for differential melting (denaturation and consequently loss of FRET) of probes from wild-type versus mutant target DNA sequences (melting curve).

Was this article helpful?

+1 0
Conquering Fear In The 21th Century

Conquering Fear In The 21th Century

The Ultimate Guide To Overcoming Fear And Getting Breakthroughs. Fear is without doubt among the strongest and most influential emotional responses we have, and it may act as both a protective and destructive force depending upon the situation.

Get My Free Ebook


Post a comment